Nov1220 deteccion de anaplasma marginale y trypanosoma vivax



Descargar 164,5 Kb.
Fecha de conversión31.05.2017
Tamaño164,5 Kb.



NOV1220
DETECCION DE Anaplasma marginale Y Trypanosoma vivax EN GARRAPATAS DE GANADO BOVINO EMPLEANDO LA REACCION EN CADENA DE LA POLIMERASA
Detection of Anaplasma marginale and Trypanosoma vivax in ticks collected from cattle using the polimerase chain reaction


RESUMEN
Utilizando la metodología PCR se detecta en garrapatas de ganado obtenidas bajo condiciones de campo, la presencia de ADN circulante para Anaplasma marginale y Trypanosoma vivax, dos de los más importantes agentes hemotrópicos que comprometen la salud de rebaños bovinos. Se discute la importancia del mecanismo de transmisión vectorial para estos agentes y las implicaciones de la circulación del vector en las zonas ganaderas estudiadas.
ABSTRACT

The PCR methodology permited obtaining in cattle ticks, under field conditions, the presence of circulating DNA for Anaplasma marginale and Trypanosoma vivax two of the most important agents haemoparasites that compromise health cattle herds. It was discussed that importance of vector trasmission mechanism for these agents and the implications of the circulation of the vector in the areas studied.



Palabras claves:

PCR, hemoparásitos, R (B.) microplus, transmisión vectorial


Key words:

PCR, haemoparasites, R (B.) microplus, vector-borne




INTRODUCCION
La anaplasmosis y tripanosomiasis -hemoparasitosis bovinas- constituyen junto a la babesiosis, el tercer complejo nosológico de mayor importancia en los sistemas de producción bovina en el mundo (Tamasaukas et al., 2000). En Venezuela son reportadas con gran frecuencia (Tamasaukas et al., 2010). A pesar de ser entidades particulares, comparten algunas características ecoepidemiológicas como distribución geográfica y algunas vías de transmisión. Entre estas, es señala la transmisión vectorial por garrapatas (Botello et al., 2011), reconocida en amplias zonas ganaderas pero desconocido el impacto en la salud del animal, estimándose que son amplias las regiones donde la industria ganadera no ha podido establecerse debido al problema que representan y las enfermedades asociadas que originan (Bell-Sakyi et al., 2004, De la Fuente et al., 2008(a), Reye et al., 2012). Al presente son reconocidas cerca de 900 especies de garrapatas distribuidas en diferentes hábitats, en Venezuela se estima entre los rebaños bovinos una prevalencia en más del 80% para la especie Rhipicephalus (Boophilus) microplus responsable de cuantiosas pérdidas económicas por sus efectos directos e indirectos (Gallardo y Morales, 1999, Botello et al., 2011).
R. (B.) microplus -denominada garrapata común del ganado-, tiene en salud bovina un gran impacto por su desempeño como transmisor de patógenos, entre estos, ser único transmisor de Babesia spp. y compartir con dípteros hematófagos este rol para A. marginale. Para T. vivax este mecanismo es discutido (De la Fuente et al., 2008(b), Botello et al., 2011). En el país la preocupación por estos agentes ha despertado gran interés por la prevalencia alarmante y las consecuencias que originan las hemoparasitosis que producen, los datos aportados por diferentes grupos de investigación demuestran que prácticamente ninguna región ganadera se encuentra libre de hemoparásitos (Tamasaukas et al., 2010), con riesgo potencial de inestabilidad enzootica si se conjugan junto a la ubicación geográfica, topografía, cambios climatológicos de la región ganadera, edad, raza, respuesta inmunológica de los bovinos, factores determinantes como movilización de animales, uso irracional de garrapaticidas y ausencia de legislación vigente en materia de salud animal (Coronado, 1996).
Las condiciones ambientales tropicales de Venezuela favorecen la supervivencia y reproducción de R. (B.) microplus todo el año (Tamasaukas et al., 2010). Al presente, pocos estudios se han realizado en el país a fin de evaluar el impacto de su presencia y distribución, desconocimiento que unido a su creciente prevalencia en regiones consideradas desfavorables, podría llevar la transmisión de hemoparásitos a poblaciones bovinas altamente susceptibles, vislumbrándose una situación de inestabilidad enzoótica, necesaria de nuevos retos en la elaboración de estrategias actualizadas de control y prevención según la realidad observada para las cuales se incluya además de la participación gubernamental, una activa participación individual con capacitación constante a veterinarios y productores (Cortez et al., 2010).
En virtud de estos antecedentes, se pretende detectar en garrapatas obtenidas de bovinos de zonas ganaderas del estado Mérida utilizando la metodología PCR, la presencia de ADN circulante para los hemoparásitos A. marginale y T. vivax, que permitan comprender la relación de la transmisión en las zonas de estudio, identificando el rol que como vector de hemoparásitos representa la garrapata común de ganado bovino.
METARIALES Y METODOS
1. Área de estudio

La investigación se realizó en fincas de dos zonas ganaderas del estado Mérida: Jají y Chiguará, pertenecientes a la denominada Zona Alta para la ganadería de la región. Ambas áreas geográficas son catalogadas como enzooticas para hemoparásitos por la presencia de factores condicionantes para la transmisión.


2. Toma de muestra

2.1. Captura de teleóginas (garrapatas hembras adultas)

Previa selección de algunos bovinos por finca en base a análisis estadísticos, se procedió al examen de la superficie corporal en busca de teleóginas (parcialmente alimentadas), deslizando la mano suavemente sobre las diferentes regiones del cuerpo donde habitualmente se localizan: región mamaria, patas traseras, ancas, flancos, abdomen, costillas y patas delanteras incluidas las axilas, cuellos y cuartos delanteros, papada y cabeza. Al detectar la garrapata, esta se desprendió directamente con los dedos índice y pulgar, tomándola lo más cerca posible del capitulo, volteándola hacia arriba y tirando suavemente de ella en contrapelo hasta desprenderla, evitando con ello que el órgano de fijación (hipostoma) quedara adherido a la piel del animal (representa un carácter taxonómico muy importante para la identificación a nivel de especie). Se recolectaron entre 5-7 garrapatas por animal en frascos individuales, rotulando según datos del animal del cual fueron colectadas, código de finca y día del muestreo. Las muestras fueron transportadas al laboratorio a la brevedad, para su procesamiento analítico.
2.2. Mantenimiento en el laboratorio

Los frascos rotulados conteniendo las teleóginas, se incubaron en cámara a 27+/-1ºC y humedad relativa del 85-86% en completa oscuridad.


3. Análisis

3.1. Teleóginas

Cada teleógina fue sometida al diagnóstico de hemolinfa mediante el corte del artejo de una pata, la gota de hemolinfa que se obtuvo se depositó sobre una lámina portaobjetos para realizar un frotis, el cual luego de fijar con metanol, se coloreó con Giemsa al 10%. La visualización microscópica con objetivos de 40X y 100X se realizó para la búsqueda de flagelados (género Trypanosoma). Adicional, se realizaron frotis sanguíneos para la búsqueda de cuerpos de inclusión de localización periférica dentro del eritrocito (género Anaplasma).
4. Clasificación taxonómica

Una vez tomada la muestra de la teológina se procedió a sacrificarla en solución de etanol al 25% (una parte) y éter etílico (tres partes), lo que facilitó la identificación taxonómica (la solución permite la dilatación de los apéndices del artrópodo) empleando claves taxonómicas para la identificación del género Rhipicephalus y del subgénero Boophilus.


5. Análisis molecular -PCR-

5.1. Extracción de ADN

Posterior a la identificación taxonómica, cada especimen se congeló a -80ºC, luego de lo cual fue macerado y depositado en tubo cónico de 1,5ml, añadiendo 100µl de buffer de lisis, incubando durante 15min a temperatura ambiente y vortex constante. Posterior, se adicionó 5µl de proteinasa K en solución, incubando en baño de agua durante 4horas a 56ºC y 10min a 70ºC. Para la purificación del ADN se utilizó el procedimiento habitual de fenol-cloroformo-alcohol isoamilico seguido de precipitación en etanol frio (Sambrook et al., 1989).
5.2. Mezcla de reacción, condiciones de ciclaje, corrida electroforética y controles de reacción

5.2.1. Mezcla de reacción

Detección de A. marginale

Se empleó para esta detección, el sistema PCR según procedimiento descrito por Stich et al., 1993, quienes emplean los primers BAP-2 (GTATGGCACGTAGTCTTGGGATCA) y AL34S (CAGCAGCAGCAAGACCTTCA) en una mezcla de reacción volumen final 25µl conteniendo 3,5mM MgCl2, 0,8mM de dNTP, 1,8µM de cada primers, 0,12U/µl de Taq polimerasa y 5µl de ADN problema en un buffer adecuado.


Detección de T. vivax

Se utilizó en la PCR para esta especie los primers TviSL1 (GCTCTCCAATCTTAACCCTA) y TviSL2 (GTTCCAGGCGTGCAAACGTC) descritos por Ventura et al., 2002. La mezcla de reacción se preparó para un volumen final de 25µl conteniendo 10X de buffer, 25mM de MgCl2, 10mM de dNTP, 20µM de cada primers, 5U/µl de Taq polimerasa y 5µl de ADN.


5.3. Corrida electroforética

El producto de PCR para A. marginale y T. vivax fue corrido sobre geles de agarosa al 1,5% y 2% respectivamente, coloreados con bromuro de ethidium y visualizados en trasluminador de luz ultravioleta. Bandas de aproximadamente 409 pares de bases correspondían a A. marginale mientras que para T. vivax, el producto de amplificación reveló bandas de aproximadamente 210 pares de bases.


5.4. Controles de reacción

Para evaluar la especificidad de la reacción se emplearon controles positivos y negativos. Los controles positivos a cada uno de los hemoparásitos descritos fueron gentilmente cedidos por un laboratorio de referencia, mientras que los controles negativos estaban representados por agua de reacción y ADN de Trypanosoma cruzi, Trypanosoma rangeli y algunas especies del género Leishmania.



RESULTADOS
Un total de 285 teleóginas fueron recolectadas de distintos muestreos de bovinos asentados en las zonas ganaderas de Jají (n=100) y Chiguará (n=185). El número de fincas incluidas en el estudio fue de 5 para ambas localidades. No hubo discriminación entre condición sanitaria del establecimiento ganadero ni antecedentes de la presencia de hemoparásitos, siendo el único requisito a valorar la infestación continua por garrapatas.
La marcha analítica aplicada permitió la identificación taxonómica de R. (B.) microplus como única especie presente. Los análisis parasitológicos directos a partir de hemolinfa y sangre no revelaron positividad ninguna de los microorganismos hacia los cuales se dirigió el diagnóstico. Los análisis de PCR revelaron ADN parasitario circulante en un total de 106 teleóginas (37,19% de reactores a PCR), correspondiendo el 90,57% de positividad a hemoparásitos (A. marginale + T. vivax) al ADN de teleóginas recolectadas de la región de Chiguará. En cuanto a la discriminación por especie, 84 correspondían a ADN de A. marginale y 22 a ADN de T vivax. No se reportó ADN circulante para T. vivax en las garrapatas recolectadas en la localidad de Jají (cuadro 1). El comportamiento de las PCR para algunas de las muestras analizadas se evidencia en la figura 1.


Cuadro 1. Positividad del diagnóstico molecular para los hemoparásitos A. marginale y

T. vivax en R (B.) microplus de dos zonas ganaderas del Estado Mérida-Venezuela





Jají

Chiguará

Totales

A. marginale

10

74

84

79,25%

T. vivax

0

22

22

20,75%




10 (9,43%)

96 (90,57%)

106








Figura 1. Reacción en Cadena de la Polimerasa para A: A. marginale (409pb) y B: T. vivax (210pb). A: PM: marcador de peso molecular, C(+): control positivo de reacción, 1, 3, 4, 7, 9, 16, 24, 27: ADN positivo A. marginale extraído a partir de R (B.) microplus. 2, 5, 6, 8, 10-15, 17- 23, 25, 26, 28, 29: ADN negativo A. marginale extraído a partir de R (B.) microplus. 30-34: controles negativos de reacción (T. cruzi, T. rangeli y algunas especies del género Leishmania respectivamente), C(-): control de reacción (agua de reacción). B: PM: marcador de peso molecular, C(-): control de reacción (agua de reacción), C(+): control positivo de reacción, 2-5, 17, 18: ADN positivo T. vivax extraído a partir de R (B.) microplus. 1, 6-13, 14-16, 19-25: ADN negativo T. vivax extraído a partir de R (B.) microplus. 26-30: controles negativos de reacción (T. cruzi, T. rangeli y algunas especies del género Leishmania respectivamente).


DISCUSION
Según lo reseña Márquez-Jiménez et al. (2005), las garrapatas representan agentes de gran importancia médica y veterinaria en razón de los patógenos que transmiten, para lo cual utilizan distintas rutas de transmisión como secreciones salivales, fluidos coxales, regurgitación y heces. Su elevado potencial vectorial está justificado -entre otros- por su prolongado período de alimentación, capacidad para alimentarse sobre distintos hospedadores, enorme potencial de dispersión (firmemente aferradas a la piel de sus hospedadores), capacidad para mantenerse vivas tras largos períodos de inanición y potencial reproductor de las hembras (capaces de depositar cientos o miles de huevos que posibilita un crecimiento poblacional rápido).
En epidemiología, un principio establece que un artrópodo hematófago que posea altos índices de reproducción en el medio ambiente así como gran resistencia a las condiciones climáticas adversas resulta candidato ideal y potencial para transmitir microorganismos patógenos (Meléndez, 1998). La glándula salival del vector hematófago R. (B.) microplus constituye el epicentro responsable de la propagación de enfermedades al funcionar como una bomba que constantemente inyecta saliva al sistema circulatorio del hospedador durante el periodo de hematofagia (Meléndez, 1998), convirtiéndola en un medio ideal para vehiculizar y transmitir microorganismos patógenos entre animales susceptibles, entre ellos los agentes hemoparásitos A. marginale y T. vivax.
Para los hemoparásitos señalados, la transferencia mecánica por garrapatas durante su fase de alimentación sobre los rumiantes ha sido principalmente señalada para A. marginale (Maranpuri, 1988, Rivera, 1996, Aubry y Geale, 2011, Reye et al., 2012), siendo pocas las investigaciones que respaldan a esta transmisión para hemoflagelados del género Trypanosoma en particular para T. vivax. Estudios directos de hemolinfa sugieren que elementos móviles reportados corresponderían a la especie Trypanosoma theileri (Sandoval et al., 1995, Rodríguez-Vivas et al., 2003, Martins et al., 2008).
Los resultados obtenidos en la presente investigación, permiten abrir el abanico de posibilidades para incriminar a R. (B.) microplus dentro de la dinámica de transmisión para estos hemoparásitos -en especial para T. vivax- en la zona muestreada, situación en parte explicada por el enorme potencial de dispersión de las garrapatas, necesitándose de nuevos estudios que evalúen la realidad en cuanto a distribución y dinámica de comportamiento ecoepidemiológico en mayor número de muestras y diferentes áreas de explotación ganadera.
Adicional, la metodología propuesta facilitaría las investigaciones sobre hemoparásitos y otros agentes hemáticos en bovinos bajo condiciones de campo, en virtud de la relativa facilidad en la toma de muestra (evitando el estrés que supone una toma de muestra venosa) y envío al laboratorio del material biológico de partida para los análisis respectivos, de tal manera que exista la posibilidad de una mayor participación comunitaria mediante la capacitación al productor y personal que labora en las instalaciones ganaderas en el manejo de esta toma de muestra.

CONCLUSIONES Y RECOMENDACIONES
La demostración mediante PCR de la infección por A. marginale y T. vivax en 106 (37,19%) garrapatas de la especie R. (B.) microplus incluidas en el estudio refleja la ventaja diagnóstica de la metodología molecular sobre los métodos parasitológicos directos utilizados para el diagnóstico de estos hemoparásitos, así como permite reafirmar el potencial vectorial de R. (B.) microplus para A. marginale y retomar la posibilidad de este potencial para T. vivax. La presente observación permite concluir que la transmisión vectorial para ambos agentes en bovinos de la región de Chiguará pareciera ser de frecuente ocurrencia y que la utilización de técnicas diagnósticas más eficientes como el ensayo de PCR podría ayudar a tener una aproximación a la realidad epidemiológica en los rebaños de esta y otras regiones de Venezuela.
LITERATURA CITADA
1. Aubry P, Geale D. A Review of Bovine Anaplasmosis. 2011. Transbound Emerg Dis. 58:1-30.

2. Bell-Sakyi L, Koney E, Dogbey O, Walker A. 2004. Incidence and prevalence of tick-borne haemoparasites in domestic ruminants in Ghana. Vet Parasitol. 124:25-42.

3. Botello A, Borroto C, Suarez M, Pérez D, Rodríguez Y, Fajardo H, Pérez K, González A, Rodríguez A, Linares B, Colicchia M, Gómez I, Peraza P, Gort A. 2011. Control de garrapatas Rhipicephalus (Boophilus) microplus en bovinos con el inmunógeno herber biogar. Redvet. 12(5):1-10.

4. Coronado A. 1996. Estado actual de la garrapata del bovino,


Boophilus microplus en Venezuela. Gaceta de Ciencias Veterinarias. 2(1): 67-74.

5. Cortés J, Betancourt J, Argüelles J, Pulido L. 2010. Distribución de garrapatas Rhipicephalus (Boophilus) microplus en bovinos y fincas del Altiplano Cundiboyacense (Colombia). Corpoica Cs Tecnol Agrop. 11(1):73-84.

6. De la Fuente J, Estrada-Pena A, Venzal J, Kocan K, Soneshine D. 2008(a). Overview: ticks as vectors of phatogens that cause disease in humans and animals. Frontiers in Biosc. 13:6938-6946.

7. De la Fuente J, Kocan K, Almazan C, Blowin E. 2008(b). Targeting the tick-pathogen interface for novel control strategies. Frontiers in Biosc. 13:6947-6956.

8. Gallardo J, Morales J. 1999. Boophilus microplus (Acaria: Ixodidae): preoviposición, oviposición, incubación de los huevos y geotropismo. Bioagro. 11(3):77-87.

9. Maranpuri G. 1988. Ticks parasitising the Indian buffalo (Bubalus bubalis) and their possible role in disease transmission. Vet Parasitol. 27(3-4):357-362.


10. Martins J, Leite R, Doyle R. 2008. Tripanosomatides like Trypanosoma theileri in the cattle tick Boophilus microplus. Rev Bras Parasitol Vet. 17(2):113-4.
11. Márquez-Jiménez F, Hidalgo-Pontiveros A, Contreras-Chova F. 2005. Las garrapatas (Acarina: Ixodida) como transmisores y reservorios de microorganismos patógenos en España. Enferm Infecc Microbiol Clin. 23(2):94-102.
12. Meléndez R. 1998. Revisión integral de los factores epidemiológicos que inciden en la relación Boophilus microplus-Bovino-Babesia spp. Rev Cs FCV-LUZ. 8(1):25-34.
13. Reye A, Arinola O, Hübschen J, Mullera C. 2012. Pathogen prevalence in ticks collected from the vegetation and livestock in Nigeria. Applied Environmental Microbiol. 78(8):2562-2568.

14. Rivera, 1996. Tripanosomiasis y anaplasmosis. En: Hemoparasitosis bovinas. UCV. Consejo de Desarrollo Científica y Humanístico. Venezuela.

15. Rodríguez-Vivas R, Quiñones-Ávila F, Ramírez-Cruz G, Ruiz-Piña H. 2003. Presencia del género Trypanosoma en la garrapata Boophilus microplus en el trópico mexicano. Rev Biomed, 14:29-33.

16. Sambrook J, Fritsch E, Maniatis. 1989. T. In vitro amplification of DNA by the PCR. In: Molecular cloning, a laboratory manual. Ed. Cold Spring Harbor Laboratory Press, USA E.3-E.4; E.10-E11pp.

17. Sandoval E, Espinoza E, Valle A. 1995. Parasitemia y comportamiento clínico en ovejas infectadas experimentalmente con Trypanosoma vivax. Vet Trop. 20:67-84.

18. Stich R, Bantle J, Kocan K, Fekete A. 1993. Detection of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in Hemolymph of Dermacentor andersoni (Acari: Ixodidae) with the Polymerase Chain Reaction. J Med Entomol. 30(4):781-788.

19. Tamasaukas R, Roa N, Aguirre A, Ron J, Cobo M. 2000. Tetralogía Hemoparasitaria en algunas Fincas Bovinas del Municipio Santa Rita, estado Guárico, Venezuela. Revista de la Facultad de Ciencias Veterinarias de la Universidad Central de Venezuela, 41(4):101-108.

20. Tamasaukas R, Agudo L, Ravelo A, Florio J, Vintimilla M, Rivera S. 2010. Hemoparasitosis en ganadería doble propósito venezolana, diagnóstico y control: una revisión. Agro Mesoamericana. 21(2):367-381.



21. Ventura R, Paiva F, Silva R, Takeda G, Buck G, Teixeira M. 2001. Trypanosoma vivax: Characterization of the Sppliced-Leader Gene of a Brazilian stock and species-specific detection by PCR amplification of an intergenic spacer sequence. Exp Parasitol. 99:37-48.
Catálogo: descargas -> articulos.a.arbitrar
descargas -> Contenido: sustantivo. Clasificación un poco de práctica
articulos.a.arbitrar -> Jun1217 redvet efecto de la extirpación quirúrgica de plumas primarias y secundarias en la familia psitácida del hogar de paso de la universidad de la amazonia en convenio con Corpoamazonia
articulos.a.arbitrar -> Nov1217 redvet estrés calorico y su relacion con variables reproductivas en machos bovinos en la amazonia colombiana (heat stress and his relation with reproductive parameters in bovine males in the colombian amazonia) Resumen
articulos.a.arbitrar -> Estudio Retrospectivo: Integración de Terapias Complementarias en la Clínica Veterinaria de Honduras
articulos.a.arbitrar -> Nov1222 redvet deteccion de anaplasma marginale y trypanosoma vivax
articulos.a.arbitrar -> Oct1227 redvet control del parásito Bothriocephalus sp en carpa barrigona
articulos.a.arbitrar -> Ene1314 redvet efecto del estrés calórico sobre la fisiología y calidad del huevo en gallinas ponedoras (Effect of heat stress on the physiology and egg quality in laying hens) resumen
articulos.a.arbitrar -> Nov1232 redvet


Compartir con tus amigos:


La base de datos está protegida por derechos de autor ©absta.info 2019
enviar mensaje

    Página principal